View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13495_low_9 (Length: 399)
Name: NF13495_low_9
Description: NF13495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13495_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 20 - 385
Target Start/End: Complemental strand, 41639464 - 41639100
Alignment:
| Q |
20 |
gaaggcgcctaagaccacttctgtcgaaaagaatgagaaaaaccaccattttgttcgaagttaccatccggatgcaagnnnnnnngaagttaattctctg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41639464 |
gaaggcgcctaagaccacttctgtcgaaaagaatgagaaaaac-accattttgttcgaagttaccatccggatgcaagaaaaaaagaagttaattctctg |
41639366 |
T |
|
| Q |
120 |
cccagattgccaaatccaaaactgcatggttttcaagaaatctgtggaagggtttgaagtagctctcttaactaaataactggtagaaaacaacactaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41639365 |
cccagattgccaaatccaaaactgcatggttttcaagaaatctgtggaagggtttgaagtagctctcttaactaaataactggtagaaaacaacactaaa |
41639266 |
T |
|
| Q |
220 |
gcgaggagaagagacaaattacaactttcatttaacacaaacacattgtgatacagtaatcctgtagcagaaaggttatgcttttgaacaagaaaattag |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41639265 |
gcgaggagaagagacaaattacaactttcatttaacagaaacacattgtgatacagtaatcctgtagaagaaaggttatgcttttgaacaagaaaattag |
41639166 |
T |
|
| Q |
320 |
taaaacatgacatgacaactctaggctgctagggaagaaaaaatcgaaatccttttaatattcttc |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41639165 |
taaaacatgacatgacaactctaggctgctagggaagaaaaaatcgaaatccttttaatattcttc |
41639100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University