View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13496_low_3 (Length: 308)
Name: NF13496_low_3
Description: NF13496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13496_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 7 - 289
Target Start/End: Complemental strand, 26568150 - 26567868
Alignment:
| Q |
7 |
gcagcacagacaattcatattgaactcgtgtccggtgtctgagtctgacacgtgttaatgtctaaaacttacacttgtgactgcatttaattattcgatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568150 |
gcagcacagacaattcatattgaactcgtgtccggtgtctgagtctgacacgtgttaatgtctaaaacttacacttgtgactgcatttaattattcgatt |
26568051 |
T |
 |
| Q |
107 |
tttcaaaattttaaccgctatcaatatctcagtgccgtgtgtctagtgtttatgtttgtatccaactaagaggataaagtagaaatgaacctgagatatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26568050 |
tttcaaaattttaaccgctatcaatatctcagtgccgtgtgtctagtgtttatgtttgtatccaactaagaggataaagtagaaatgaacctgagatatc |
26567951 |
T |
 |
| Q |
207 |
ttagggaggtcagaaagatttctgtcctttgcaatggctcggatcaaatctcttttttcttgtacatactccctgcacattgt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26567950 |
ttagggaggtcagaaagatttctgtcctttgcaatggctcggatcaaatctcttttttcttgtacatactccctgcacattgt |
26567868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University