View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13496_low_5 (Length: 236)

Name: NF13496_low_5
Description: NF13496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13496_low_5
NF13496_low_5
[»] chr5 (2 HSPs)
chr5 (1-69)||(8218976-8219044)
chr5 (154-224)||(8219129-8219199)


Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 8218976 - 8219044
Alignment:
1 atagtgaatcaacttaatccaactcaacttaacacagttaggtgataagttgggtaaactggatgtttc 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8218976 atagtgaatcaacttaatccaactcaacttaacacagttaggtgataagttgggtaaactggatgtttc 8219044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 224
Target Start/End: Original strand, 8219129 - 8219199
Alignment:
154 gagacgtgagatatactcaaatttatacttgagctggcgtggatcaggttgatgagtaacagaagaaagtg 224  Q
    ||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||| ||||||||||    
8219129 gagacgtgagatatacataaatttatacttgagctggcgtggatcaggttgatgagtaacggaagaaagtg 8219199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University