View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13496_low_5 (Length: 236)
Name: NF13496_low_5
Description: NF13496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13496_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 8218976 - 8219044
Alignment:
| Q |
1 |
atagtgaatcaacttaatccaactcaacttaacacagttaggtgataagttgggtaaactggatgtttc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8218976 |
atagtgaatcaacttaatccaactcaacttaacacagttaggtgataagttgggtaaactggatgtttc |
8219044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 154 - 224
Target Start/End: Original strand, 8219129 - 8219199
Alignment:
| Q |
154 |
gagacgtgagatatactcaaatttatacttgagctggcgtggatcaggttgatgagtaacagaagaaagtg |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8219129 |
gagacgtgagatatacataaatttatacttgagctggcgtggatcaggttgatgagtaacggaagaaagtg |
8219199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University