View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13498_high_35 (Length: 324)
Name: NF13498_high_35
Description: NF13498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13498_high_35 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 202 - 324
Target Start/End: Complemental strand, 35443393 - 35443271
Alignment:
| Q |
202 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443393 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
35443294 |
T |
|
| Q |
302 |
atacacttcactcattgttgatt |
324 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35443293 |
atacacttcactcattgttgatt |
35443271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 35443580 - 35443538
Alignment:
| Q |
1 |
aagtcaaataatttgattttgtaccttgaatatataattttat |
43 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35443580 |
aagttaaataatttgattttgtacattgaatatataattttat |
35443538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University