View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13498_high_36 (Length: 322)
Name: NF13498_high_36
Description: NF13498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13498_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 33081632 - 33081943
Alignment:
| Q |
1 |
gagcaaccggcccaaaggggatgagctttgaaagcagcttccatattagcaagaaagtcttgtacggcatcactgtctctctcaggatcgggtccatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081632 |
gagcaaccggcccaaaggggatgagctttgaaagcagcttccatattagcaagaaagtcttgtacggcatcactgtctctctcaggatcgggtccatgat |
33081731 |
T |
 |
| Q |
101 |
ttgaaaatgaaactatgaaactgtaaaattataattattgcaatgcatcagtgaattgattagggttcggattgaaattaagatggtgaaaagaagaagg |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081732 |
ttgaaaacgaaactatgaaactgtaaaatcataattattgctatgcatcagtgaattgattagggttcggattgaaattaagatggtgaaaagaagaagg |
33081831 |
T |
 |
| Q |
201 |
aaggaaccttttgatagctttgacgaaatcggcggcggcgggttggcgcatgcgctcgaggaagtcgtgtaaaccagaggaagcgtcggcgttttccatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33081832 |
aaggaaccttttgatagctttgacgaaatcggcggcggcgggttggcgcatgcgctcgaggaagtcgtgtaaaccagaggaagcgtcggcgttttccatt |
33081931 |
T |
 |
| Q |
301 |
acactgtctgtg |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33081932 |
acactgtctgtg |
33081943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University