View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13499_high_4 (Length: 221)
Name: NF13499_high_4
Description: NF13499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13499_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 24481254 - 24481335
Alignment:
| Q |
18 |
catagggagcgggtggtggggatttatagatatatggtggagactcataaacatatggagggggtataggtttgtagtagta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24481254 |
catagggagcgggtggtggggatttatagatatatggtggagactcataaacatatggagggggtataggtttgtagtagta |
24481335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 200
Target Start/End: Original strand, 24481402 - 24481436
Alignment:
| Q |
166 |
tttgtagacatattgtggaggaggaggtgattcgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24481402 |
tttgtagacatattgtggaggaggaggtgattcgt |
24481436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University