View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13499_low_4 (Length: 221)

Name: NF13499_low_4
Description: NF13499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13499_low_4
NF13499_low_4
[»] chr4 (2 HSPs)
chr4 (18-99)||(24481254-24481335)
chr4 (166-200)||(24481402-24481436)


Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 99
Target Start/End: Original strand, 24481254 - 24481335
Alignment:
18 catagggagcgggtggtggggatttatagatatatggtggagactcataaacatatggagggggtataggtttgtagtagta 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24481254 catagggagcgggtggtggggatttatagatatatggtggagactcataaacatatggagggggtataggtttgtagtagta 24481335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 166 - 200
Target Start/End: Original strand, 24481402 - 24481436
Alignment:
166 tttgtagacatattgtggaggaggaggtgattcgt 200  Q
    |||||||||||||||||||||||||||||||||||    
24481402 tttgtagacatattgtggaggaggaggtgattcgt 24481436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University