View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350-INSERTION-6 (Length: 464)
Name: NF1350-INSERTION-6
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350-INSERTION-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 7e-87; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 8 - 174
Target Start/End: Complemental strand, 9877396 - 9877230
Alignment:
| Q |
8 |
gattttcggtcatcttcttacgagtagtaattatgacgataatgtgaagaaaactactggtggaagaaacggttatggtgctaagctcacgaatattttc |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877396 |
gatttttggtcatcttcttacgagtagtaattatgacgataatgtgaagaaaactactggtggaagaaacggttatggtgctaagctcacgaatattttc |
9877297 |
T |
|
| Q |
108 |
tcgactgagtttgttattgaaactgctgatggacggaggttgaagaagtataagcaggtagtgattc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877296 |
tcgactgagtttgttattgaaactgctgatggacggaggttgaagaagtataagcaggtagtgattc |
9877230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 342 - 464
Target Start/End: Complemental strand, 9877062 - 9876940
Alignment:
| Q |
342 |
atgctgtgaactgaaattgattttgaatttgttgatttagggttctgttaaggtttttagtgtttggtactgtgaattaaacttgaatttgtggatttat |
441 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877062 |
atgctgtgaactgaaattgattttgaatttgttgatttagggttctgttaaggtttttagtgtttggtactgtgaattaaacttgaatttgtggatttat |
9876963 |
T |
|
| Q |
442 |
gatgattttgttagggtttttag |
464 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9876962 |
gatgattttgttagggtttttag |
9876940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 46 - 173
Target Start/End: Complemental strand, 38841289 - 38841162
Alignment:
| Q |
46 |
ataatgtgaagaaaactactggtggaagaaacggttatggtgctaagctcacgaatattttctcgactgagtttgttattgaaactgctgatggacggag |
145 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||| |||| |||||||||||||| | || ||||||||| | |
|
|
| T |
38841289 |
ataatgtgaagaaaactactggtgggagaaatggttatggtgctaagctcaccaatattttttcgaaggagtttgttattgagattgttgatggacgtcg |
38841190 |
T |
|
| Q |
146 |
gttgaagaagtataagcaggtagtgatt |
173 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38841189 |
tttgaagaagtataagcaggtagtgatt |
38841162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 346 - 407
Target Start/End: Complemental strand, 9876802 - 9876741
Alignment:
| Q |
346 |
tgtgaactgaaattgattttgaatttgttgatttagggttctgttaaggtttttagtgtttg |
407 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
9876802 |
tgtgaattgaaattgattttgaatttgttgatttaggcttctgctactgtttttagtgtttg |
9876741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University