View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350-INSERTION-7 (Length: 496)
Name: NF1350-INSERTION-7
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350-INSERTION-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 7 - 385
Target Start/End: Original strand, 47758970 - 47759354
Alignment:
| Q |
7 |
ataacaaaacaaaatcacacactagagataaaacagagctccacacaatagaatcnnnnnnn------catattaaccaattacaataacatcaatcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47758970 |
ataacaaaacaaaatcacacactagagataaaacagagatccacacaataaaataaaataaaataaaacatattaaccaattacaataacatcaatcatt |
47759069 |
T |
|
| Q |
101 |
catcaacataatttgatccactttcgcattgaatttaccttatgagaacaatgtagagcttcttgcctttatgattaatagcccaagtttccatagcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47759070 |
catcaacataatttgatccactttcgcattgaatttaccttatgagaacaatgtagagcttcttgcctttatgattaatagcccaagtttccatagcatc |
47759169 |
T |
|
| Q |
201 |
agcagaactgattcgcggtaatctagctttcgtagattcaccaccatgagcagaaacatcactcaccggatctcctctctcaccttcagataaatcctca |
300 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47759170 |
agcagaactgattcgcggcaatctagctttcgtagattcaccaccatgagcagaaacatcactcaccggatctcctctctcaccttcagataaatcctca |
47759269 |
T |
|
| Q |
301 |
gacatatcagcagtagcttctcttctccctctttcacgttccaacctccttttcgtcactctctgcaccgcctcactctcaagct |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47759270 |
gacatatcagcagtagcttctcttctccctctttcacgttccaacctccttttcgtcactctctgcaccgcctcactctcaagct |
47759354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 448 - 496
Target Start/End: Original strand, 47759425 - 47759473
Alignment:
| Q |
448 |
gaagaaactgaacctgcttcttctgacgagcaaggttccaaattctcca |
496 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47759425 |
gaagaaactgaacctgcttcttctgacgagcaaggttccaaattctcca |
47759473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 315 - 362
Target Start/End: Original strand, 45399191 - 45399238
Alignment:
| Q |
315 |
agcttctcttctccctctttcacgttccaacctccttttcgtcactct |
362 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||| |||||||| |
|
|
| T |
45399191 |
agcttctcttctccctctttcatggtccaacctccgttttgtcactct |
45399238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University