View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350-Insertion-21 (Length: 228)
Name: NF1350-Insertion-21
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350-Insertion-21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 7 - 183
Target Start/End: Complemental strand, 10434209 - 10434033
Alignment:
| Q |
7 |
aagagtatctttccctggccaccgccaaacgggaacgaagaaaagcttcagcactttgtcgtattcaacaagatcagcgcgtgaattgcagttgatgcac |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10434209 |
aagagtgtctttccctggccaccgccaaacgggaacgaagaaaagtttcagaactttgtcgtattcaacaagatcagcgcgtgaattgcagttgatgcac |
10434110 |
T |
|
| Q |
107 |
cttcccacacctgatttcaccacctggcgaacctggttttctaaccctcctgcaaagaagaagaacatttttcaact |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10434109 |
cttcccacacctgatttcaccacctggcgaacctggttttctatccctcctgcaaagaagaagaacatttttcaact |
10434033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University