View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350-Insertion-26 (Length: 138)
Name: NF1350-Insertion-26
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350-Insertion-26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 7 - 134
Target Start/End: Original strand, 53639133 - 53639262
Alignment:
| Q |
7 |
atgaagaagatatgtaacttaaacaacacatattgaatgaattttccccnnnnnnnn--cacatgttgaatttcaaccgtaggttaatattgcatggaca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53639133 |
atgaagaagatatgtaacttaaacaacacatattgaatgaattttccccaaaaaaaaaacacatgttgaatttcaaccgtaggttaatattgcatggaca |
53639232 |
T |
 |
| Q |
105 |
gttgtattagtataagtaagtaagtaacta |
134 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
53639233 |
gttgtattagtataagtaagtaactaacta |
53639262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University