View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350-Insertion-28 (Length: 87)
Name: NF1350-Insertion-28
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350-Insertion-28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 59; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 1e-25
Query Start/End: Original strand, 13 - 79
Target Start/End: Original strand, 44989805 - 44989871
Alignment:
| Q |
13 |
ttgatctggtatgcaactctgtctgtggtctatccaagaaacctcattatatgtctgtcattctctt |
79 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44989805 |
ttgatctggtatgcaactatgtctctggtctatccaagaaacctcattatatgtctgtcattctctt |
44989871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University