View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350-Insertion-9 (Length: 469)
Name: NF1350-Insertion-9
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350-Insertion-9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 9e-71; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 225 - 364
Target Start/End: Original strand, 41531870 - 41532009
Alignment:
| Q |
225 |
tctttaacattgatgtttgatatccagtatgatgattttcataaaatatttcaccgatttttggtcttgaaagcaccaaatattaaactaaacatcaaat |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531870 |
tctttaacattgatgtttgatatccagtatgatgattttcataaaatatttcaccgatttttggtcttgaaagcaccaaatattaaactaaacatcaaat |
41531969 |
T |
 |
| Q |
325 |
gaaagttttgtatggactaaacatagtatgagaataatcc |
364 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531970 |
gaaaattttgtatggactaaacatagtatgagaataatcc |
41532009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 7 - 92
Target Start/End: Original strand, 41531652 - 41531737
Alignment:
| Q |
7 |
atatactaaccacaacaacttaaccttatcgcataaagtagagtcgtcaaatatatatagagagtattaagctttagtgttgtctc |
92 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41531652 |
atatactaaccacaacaacttaaccttatagcataaagtagagtcgtcaaatatatatagagagtattaagctttagtgttgtctc |
41531737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 389 - 469
Target Start/End: Original strand, 41532028 - 41532108
Alignment:
| Q |
389 |
catagtatgagaagttcacaacacatcatccttagaaatattttgtcacagtaagatcgttcgtgaaaaaatgagtgatag |
469 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41532028 |
catagtatgagaagttcacaacacatcatccttagaaatattttgtcacagtaagattgttcgtgaaaaaatgagtgatag |
41532108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University