View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13500_high_5 (Length: 268)
Name: NF13500_high_5
Description: NF13500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13500_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 148 - 250
Target Start/End: Complemental strand, 33157410 - 33157308
Alignment:
| Q |
148 |
cctggtactgtcggctaaggaaacatacacactggaccaaaatacctttagctnnnnnnnncatcaatatcccttttaatacttgacctatacatctaca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33157410 |
cctggtactgtcggctaaggaaacatacacactggaccaaaatacctttagctaaaaaaaccatcaatatcccttttaatacttgacctatacatctaca |
33157311 |
T |
 |
| Q |
248 |
tct |
250 |
Q |
| |
|
||| |
|
|
| T |
33157310 |
tct |
33157308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University