View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13500_low_7 (Length: 314)
Name: NF13500_low_7
Description: NF13500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13500_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 330809 - 331089
Alignment:
| Q |
18 |
ggtggatatcccggtggcggatatccttgtggtggatacccttgcggtggataaccttgcggtggatacccttgaggtggatatccttgtggaggatgtc |
117 |
Q |
| |
|
|||||||| || ||||| |||||||| |||| ||||| |||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
330809 |
ggtggataacctggtggtggatatcccggtggcggatatccttgcggtggatacccttgcggtggatacccttgtggtggatacccttgtggaggatgtc |
330908 |
T |
 |
| Q |
118 |
cttcctttgcatcagatggtggataacctattcataataaataaatcatgagattgattgagaaatgtaaaatgaataaagc-------agacaaagcaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
330909 |
cttcctttgcatcagatggtggataacctattc---ataaataaatcatga----gattgagaaatgtaaaatgaataatgcggacattagacaaagcaa |
331001 |
T |
 |
| Q |
211 |
tcaataatgattacgtatgtaccttgaggcggtggaaccccgaccggtggttgttgctgattgtattgactcattggtggcgatgatg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
331002 |
tcaataatgattacgtatgtaccttgaggcggtggaaccccgaccggtggttgttgctgattgtattgactcattggtggcgatgatg |
331089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University