View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13501_high_10 (Length: 257)
Name: NF13501_high_10
Description: NF13501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13501_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 72 - 240
Target Start/End: Original strand, 18612450 - 18612617
Alignment:
| Q |
72 |
atcgacattcta-caattttgtagataaatttattttagagtataattgaaaatcaaaaggtcactttaaaaccatgtatttcatttaaataaaatatag |
170 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18612450 |
atcgacattctaacaattttgtagataaatttattttagagtataattgaaaatcaaaaggtcactttaaaaccatgtatttcatttaaataaaatatag |
18612549 |
T |
 |
| Q |
171 |
atgtatagatcatgattgactgattattgatttgcttgt-aattgtgattacagattctaagggcaatact |
240 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18612550 |
atgtatag---atgattgactgattattgatttggttgtcaattgtgattacagattctaagggcaatact |
18612617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University