View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13501_high_12 (Length: 232)

Name: NF13501_high_12
Description: NF13501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13501_high_12
NF13501_high_12
[»] chr5 (2 HSPs)
chr5 (14-216)||(42229935-42230137)
chr5 (56-135)||(29503874-29503953)


Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 42230137 - 42229935
Alignment:
14 agcataggtggaatgttggcaagtagaataatgaacctgaattggaaatttagaggaaatgaaatagtaatggtgaataatttacctgtgcaaatctttt 113  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42230137 agcatagatggaatgttggcaagtagaataatgaacctgaattggaaatttagaggaaatgaaatagtaatggtgaataatttacctgtgcaaatctttt 42230038  T
114 gggatgtgcatgattggttgttcaatgaccttggttcaggccctgccgtgtttattttcaagccaggaaatttggaaacagatgattctaatagcagaga 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
42230037 gggatgtgcatgattggttgttcaatgaccttggttcaggccctgccgtgtttattttcaagccaggaattttggaaacagatgattctaatagcagaga 42229938  T
214 atg 216  Q
    |||    
42229937 atg 42229935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 135
Target Start/End: Original strand, 29503874 - 29503953
Alignment:
56 tggaaatttagaggaaatgaaatagtaatggtgaataatttacctgtgcaaatcttttgggatgtgcatgattggttgtt 135  Q
    |||||||||||||| ||| |||  || ||||| |||||   |||||||||| | ||||||||||| ||||||||||||||    
29503874 tggaaatttagagggaatcaaactgttatggttaataaacaacctgtgcaagttttttgggatgttcatgattggttgtt 29503953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University