View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13501_low_10 (Length: 345)
Name: NF13501_low_10
Description: NF13501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13501_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 93 - 337
Target Start/End: Original strand, 224335 - 224577
Alignment:
| Q |
93 |
tgcttcaagatccaaatgagcaaaagcattccattaaagcctaacaatgccatagttttggtgaatgtaaattgtaaaatatcaaacacgatcaagttgt |
192 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
224335 |
tgcttcaagaaccaaatgagcaaaagcattccattaaagcctaacaatgccatagtt--ggtgaatgtaaattgtaaaatatcaaacaagatcaagttgt |
224432 |
T |
 |
| Q |
193 |
aacacaactggcgatgatttcttaatcaactcaaccttgcatttatcaccgtttgacaaattgttgtccgttgcaaatttaatgaatcctttccccaatc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
224433 |
aacacaactggcgatgatttcttaatcaactcaaccttgcatttatcaccgtttgacaaattgttgtacgttgcaaatttaatgaatcctttccccaatc |
224532 |
T |
 |
| Q |
293 |
gcagtcctgaacgacctaaacgtgtacaacaaacatccctttgct |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
224533 |
gcagtcctgaacgacctaaacgtgtacaacaaacatcccattgct |
224577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 64
Target Start/End: Complemental strand, 224294 - 224260
Alignment:
| Q |
30 |
gaataattatcacatgagtttgactgagccattct |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
224294 |
gaataattatcacatgagtttgactgagccattct |
224260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University