View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13501_low_11 (Length: 312)
Name: NF13501_low_11
Description: NF13501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13501_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 15 - 160
Target Start/End: Complemental strand, 49927934 - 49927789
Alignment:
| Q |
15 |
gagatgaaacggaggagttcgatgacggcgtcgggagtccaaatgagattggaaggaggagaggttgtttcgaatggaatgtctttgatgactgctacaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49927934 |
gagatgaaacggaggagttcgatgacggcgtcgggagtccaaatgagattggaaggaggagaggttgtttcgaatggaatgtctttgatgactgctacaa |
49927835 |
T |
 |
| Q |
115 |
gtgcttgttttgcgaggagccgtttatcgtaaggacgcaacttcaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49927834 |
gtgcttgttttgcgaggagccgtttatcgtaaggacgcaacttcaa |
49927789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 185 - 296
Target Start/End: Complemental strand, 49927773 - 49927659
Alignment:
| Q |
185 |
gcataacacacgatacaatacggtttgtttcagagtgtggggggtatggtatgtgagtgtttttatcga---tattgtttatgttagatgatatatttca |
281 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49927773 |
gcatagcacacgatacaatacggtttgtttcagagtgtggggggtatggtatgtgagtgtttttatcgatattattgtttatgttagatgatatatttca |
49927674 |
T |
 |
| Q |
282 |
ttttgaagatgatgt |
296 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
49927673 |
ttttgaagatgatgt |
49927659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University