View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13501_low_12 (Length: 266)
Name: NF13501_low_12
Description: NF13501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13501_low_12 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 34867568 - 34867821
Alignment:
| Q |
13 |
aatatatggcatgagattttaaggatcatttcggtgttatctgagtgaaaacaatatacaacctcaaaaatcaagctcaatactgaaacatggcagatta |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34867568 |
aatatgtggcatgagattttaaggatcatttcggtgttatctgagtgaaaacaatatacaaactcaaaaatcaagctcaatactgaaacatggcagatta |
34867667 |
T |
 |
| Q |
113 |
acagggtgattttactgattctatcctcgattcagttttacacagaattccccaaaatcattttagatacaggactcagatttggtttcaaatttgccaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34867668 |
acagggtgattttactgattctatcctcgattcagttttacgcagaattccccaaaatcattttagatacaggacttagatttggtttcaaatttgccaa |
34867767 |
T |
 |
| Q |
213 |
atccaaacctgattcttgtcttattaaccttgacaaaccataaaaccactctct |
266 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
34867768 |
atccaaacttgattcttgtcttatcaaccttgacaaaccataacaccactctct |
34867821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University