View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13501_low_15 (Length: 232)
Name: NF13501_low_15
Description: NF13501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13501_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 42230137 - 42229935
Alignment:
| Q |
14 |
agcataggtggaatgttggcaagtagaataatgaacctgaattggaaatttagaggaaatgaaatagtaatggtgaataatttacctgtgcaaatctttt |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42230137 |
agcatagatggaatgttggcaagtagaataatgaacctgaattggaaatttagaggaaatgaaatagtaatggtgaataatttacctgtgcaaatctttt |
42230038 |
T |
|
| Q |
114 |
gggatgtgcatgattggttgttcaatgaccttggttcaggccctgccgtgtttattttcaagccaggaaatttggaaacagatgattctaatagcagaga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42230037 |
gggatgtgcatgattggttgttcaatgaccttggttcaggccctgccgtgtttattttcaagccaggaattttggaaacagatgattctaatagcagaga |
42229938 |
T |
|
| Q |
214 |
atg |
216 |
Q |
| |
|
||| |
|
|
| T |
42229937 |
atg |
42229935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 135
Target Start/End: Original strand, 29503874 - 29503953
Alignment:
| Q |
56 |
tggaaatttagaggaaatgaaatagtaatggtgaataatttacctgtgcaaatcttttgggatgtgcatgattggttgtt |
135 |
Q |
| |
|
|||||||||||||| ||| ||| || ||||| ||||| |||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
29503874 |
tggaaatttagagggaatcaaactgttatggttaataaacaacctgtgcaagttttttgggatgttcatgattggttgtt |
29503953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University