View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13502_high_3 (Length: 217)
Name: NF13502_high_3
Description: NF13502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13502_high_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 86 - 191
Target Start/End: Original strand, 30124905 - 30125010
Alignment:
| Q |
86 |
ttgcaaaaatgttttctacaatgtcagtaagtggaatatctatctaacaataacagtaatatgatttcagaaacagcggctagtaacagcatgtatatat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
30124905 |
ttgcaaaaatgttttctacaatgtcagtaagtggaatatctatctaactataacagtaatatgatttcagaaacagtggctagtaacaacatgtatatat |
30125004 |
T |
 |
| Q |
186 |
tttcaa |
191 |
Q |
| |
|
|||||| |
|
|
| T |
30125005 |
tttcaa |
30125010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 113 - 183
Target Start/End: Original strand, 29353911 - 29353981
Alignment:
| Q |
113 |
taagtggaatatctatctaacaataacagtaatatgatttcagaaacagcggctagtaacagcatgtatat |
183 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29353911 |
taagtggaatatctatcgtacaatcacaataatatgatttcagaaacagtggctagtaacagcatgtatat |
29353981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 103
Target Start/End: Complemental strand, 29939146 - 29939111
Alignment:
| Q |
68 |
ttctaggctctgtttactttgcaaaaatgttttcta |
103 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29939146 |
ttctaggctccgtttactttgcaaaaatgttttcta |
29939111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University