View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13502_low_3 (Length: 217)

Name: NF13502_low_3
Description: NF13502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13502_low_3
NF13502_low_3
[»] chr6 (3 HSPs)
chr6 (86-191)||(30124905-30125010)
chr6 (113-183)||(29353911-29353981)
chr6 (68-103)||(29939111-29939146)


Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 86 - 191
Target Start/End: Original strand, 30124905 - 30125010
Alignment:
86 ttgcaaaaatgttttctacaatgtcagtaagtggaatatctatctaacaataacagtaatatgatttcagaaacagcggctagtaacagcatgtatatat 185  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |||||||||||    
30124905 ttgcaaaaatgttttctacaatgtcagtaagtggaatatctatctaactataacagtaatatgatttcagaaacagtggctagtaacaacatgtatatat 30125004  T
186 tttcaa 191  Q
    ||||||    
30125005 tttcaa 30125010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 113 - 183
Target Start/End: Original strand, 29353911 - 29353981
Alignment:
113 taagtggaatatctatctaacaataacagtaatatgatttcagaaacagcggctagtaacagcatgtatat 183  Q
    |||||||||||||||||  ||||| ||| |||||||||||||||||||| |||||||||||||||||||||    
29353911 taagtggaatatctatcgtacaatcacaataatatgatttcagaaacagtggctagtaacagcatgtatat 29353981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 68 - 103
Target Start/End: Complemental strand, 29939146 - 29939111
Alignment:
68 ttctaggctctgtttactttgcaaaaatgttttcta 103  Q
    |||||||||| |||||||||||||||||||||||||    
29939146 ttctaggctccgtttactttgcaaaaatgttttcta 29939111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University