View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13503_high_4 (Length: 251)
Name: NF13503_high_4
Description: NF13503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13503_high_4 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 34877984 - 34878218
Alignment:
| Q |
20 |
ttggtttgatgatattagtttgagacttgagagtttcttcttctttgatgttttaagtttaattccgatgccatt-----taggtaggctaatttaattt |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||| || |||| ||| |
|
|
| T |
34877984 |
ttggtttggtgatattagtttgagacttgagagtctcttcttctttgatgttttaagtttaattccgatatcattacatttaggtaggttagtttagttt |
34878083 |
T |
 |
| Q |
115 |
ctttaaaaaattaaagaaccaatgtcgaactcaagtcgtgttttcagttgaactaannnnnnngttgagtagaggttaattgtgtcaaatttgactcaac |
214 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34878084 |
cttttaaaaaataatgaaccaatgtcgaactcaagtcgagttttcagttgaactaattttt--gttgagtagaggttaattgtgtcaaatttgactcaac |
34878181 |
T |
 |
| Q |
215 |
tacactcatttgcagctcaatattgttctaccgcggt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34878182 |
tacactcatttgcagctcaatattgttctaccgcggt |
34878218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 124
Target Start/End: Original strand, 32880790 - 32880822
Alignment:
| Q |
92 |
atttaggtaggctaatttaatttctttaaaaaa |
124 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
32880790 |
atttaggtaggctaatttaacttctttaaaaaa |
32880822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University