View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13506_high_10 (Length: 268)
Name: NF13506_high_10
Description: NF13506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13506_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 20 - 251
Target Start/End: Complemental strand, 8630710 - 8630475
Alignment:
| Q |
20 |
aatctgtcaatttaatttgtttgtcaatcatattacaactaaattatatagcattgttggcgagatagtgagataccaactaatatgataaggattctaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8630710 |
aatctgtcaatttaatttgtttgtcaatcatattacaactaaattatatagcattgttggcgagatagtgagataccaactaatatgataaggattctaa |
8630611 |
T |
 |
| Q |
120 |
tttagtcgaggttttatgtgaaatttaccatgccattttacctgtcatatttgcata---tgagagatatattacgttaagcaccataatcttaaaatca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8630610 |
tttagtcgaggttttatgtgaaatttaccatgccattttacctgtcatatttgcatatactgagagatatattacgttaagcaccataatcttaaaatca |
8630511 |
T |
 |
| Q |
217 |
tatggatctagctgagtattt-ccccctcttatttt |
251 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8630510 |
tatggatctagctgagtatttcccccctcttatttt |
8630475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University