View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13506_low_10 (Length: 316)
Name: NF13506_low_10
Description: NF13506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13506_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 296
Target Start/End: Complemental strand, 14148399 - 14148117
Alignment:
| Q |
1 |
gaagaagaggttgtaagagaaacttaggtcgaaacggccgtagccgaggtcagcacctccgtgacagtgtccatgctggaggaaacacccttccctcacc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14148399 |
gaagaagaggttgtaagagaaacttgggtcgaaacggccgtagccgaggtcagcacctccgtgacagtgtccatgctggaggaa--acccttccctcacc |
14148302 |
T |
 |
| Q |
101 |
actcctcttccagttcaaggtattcatatctttttcatttttctttgnnnnnnnntataaattactgttttaaaacaaaataacctttttaaaactttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
14148301 |
actcctcttccagttcaaggtattcatatatttttcatttttctttgaaa------ataaattactgttttaaaaca----aacctttttagaactttc- |
14148213 |
T |
 |
| Q |
201 |
atatatttgtttgttacatattcttt-aaaaaagtt-cgagaatctgaaaaat-atataaatgtatgaaaattgagaatttgaaatctcagttgcctag |
296 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14148212 |
---tattggtttgttacatattctttaaaaaaagttacgagaatctgaaaaataatataaatgtatgaaaattgagaatttgaaatctcagttgcctag |
14148117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 28 - 75
Target Start/End: Original strand, 2129593 - 2129640
Alignment:
| Q |
28 |
gtcgaaacggccgtagccgaggtcagcacctccgtgacagtgtccatg |
75 |
Q |
| |
|
||||||| || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2129593 |
gtcgaaaaggtcgtagccgaggtcagcacatccgtgacagtgtccatg |
2129640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University