View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13506_low_6 (Length: 396)
Name: NF13506_low_6
Description: NF13506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13506_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 3e-55; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 23 - 183
Target Start/End: Original strand, 24766812 - 24766970
Alignment:
| Q |
23 |
tacagcgtttacacagcaaactcataatgtctaagctaacactcttgtgttatgtttaaattacgacattcttgcatataccgacgatgttgtgaactcc |
122 |
Q |
| |
|
||||| |||| |||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
24766812 |
tacagtgtttgcacaacaaactcataatgtctaagctaccactcttgcgttatgtttaaattacgacattcttgcatataccggcga--ttgtgaactcc |
24766909 |
T |
|
| Q |
123 |
gctatttttaataaggaccacaacggagtaataatggttacattattgggaattgccctgt |
183 |
Q |
| |
|
|||||||||||| ||||||| || |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24766910 |
gctatttttaatgaggaccaaaatggagtaataatggttacattattgggaattaccctgt |
24766970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 252 - 327
Target Start/End: Original strand, 24767039 - 24767114
Alignment:
| Q |
252 |
gttttgctgtttacttgatgtcgatgttagcagattcccatgcggtggtgaaaaagtttttctgcacaacctttaa |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24767039 |
gttttgctgtttacttgatgtcgatgttagcagattctcatgcaatggtgaaaaagtttttctgcacaacctttaa |
24767114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 322 - 379
Target Start/End: Original strand, 24767142 - 24767199
Alignment:
| Q |
322 |
ctttaagtttatatgcactgttttctatgacttttggataagcaaaggacgtgatttg |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24767142 |
ctttaagtttatatgcactgttttctatgacttttggataagcaaaggacgtgatttg |
24767199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University