View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13507_low_14 (Length: 265)
Name: NF13507_low_14
Description: NF13507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13507_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 20 - 247
Target Start/End: Complemental strand, 54538983 - 54538757
Alignment:
| Q |
20 |
ataacaataaataccatcctgagagcataaattatctcttgaaggataagcttgtnnnnnnnntaatttcaaatatcagttcannnnnnnnnaacatcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||| |||||||| |
|
|
| T |
54538983 |
ataacaataaataccatcctgagagcataa-ttatctcttgaaggataaatttgtaaaaaaaataatttcaaatatcagttcatttttattgaacatcat |
54538885 |
T |
 |
| Q |
120 |
aacaaaagttacatatattnnnnnnnnngttgttgctttgataaatttattcaaatattcgtcgttgttacccttaagtgtatatgtcattctaataaat |
219 |
Q |
| |
|
||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54538884 |
aacaaaagtcacagatattaaagaaaaagttgttgctttgataaatttattcaaatattcgtcgttgttacccttaagtgtatatgtcattctaataaat |
54538785 |
T |
 |
| Q |
220 |
tatattttcccaaatcatgtcattttac |
247 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
54538784 |
tatattttctttaatcatgtcattttac |
54538757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University