View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13508_high_4 (Length: 206)
Name: NF13508_high_4
Description: NF13508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13508_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 16 - 183
Target Start/End: Original strand, 32825144 - 32825311
Alignment:
| Q |
16 |
agagaataaggacttgaagttcttcaatgtgtttttgaagaacttcttagtggtagtaatagagcttcttagtagcattggtgatgctagtttatagata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32825144 |
agagaataaggacttgaagttcttcaatgtgtttttgaagaacttcttagtggtagtaatagagcttcttagtagcattggtgatgctagtttatagata |
32825243 |
T |
 |
| Q |
116 |
tagatagtactatttattttannnnnnngtataataattgtaaaatgcaatacctttgatgaagatca |
183 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32825244 |
tagatagtactatttatttattttttttgtataataattgtaaaatgcaatacctttgatgaagatca |
32825311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University