View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13508_low_6 (Length: 206)

Name: NF13508_low_6
Description: NF13508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13508_low_6
NF13508_low_6
[»] chr6 (1 HSPs)
chr6 (16-183)||(32825144-32825311)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 16 - 183
Target Start/End: Original strand, 32825144 - 32825311
Alignment:
16 agagaataaggacttgaagttcttcaatgtgtttttgaagaacttcttagtggtagtaatagagcttcttagtagcattggtgatgctagtttatagata 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32825144 agagaataaggacttgaagttcttcaatgtgtttttgaagaacttcttagtggtagtaatagagcttcttagtagcattggtgatgctagtttatagata 32825243  T
116 tagatagtactatttattttannnnnnngtataataattgtaaaatgcaatacctttgatgaagatca 183  Q
    |||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||    
32825244 tagatagtactatttatttattttttttgtataataattgtaaaatgcaatacctttgatgaagatca 32825311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University