View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13509_high_2 (Length: 203)
Name: NF13509_high_2
Description: NF13509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13509_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 18 - 173
Target Start/End: Complemental strand, 32083220 - 32083065
Alignment:
| Q |
18 |
actagagggaaatgagagggtcaacataaattgtaatgtttttgcaattatacagcatctcacaatatgatgataaattcggtaagtgtatcaaatcata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32083220 |
actagagggaaatgagagggtcaacataaattttaatgtttttgcaattatacagcatctcacaatatgatgataaattcggtaagtgtatcaaatcgta |
32083121 |
T |
 |
| Q |
118 |
taaattataaagtagtaagtcaatcgtcttcatatatatcgttgttttcttccttc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32083120 |
taaattataaagtagtaagtcaatcgtcttcatatgtatcgttgttttcttccttc |
32083065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University