View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350R-Insertion-4 (Length: 230)
Name: NF1350R-Insertion-4
Description: NF1350R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350R-Insertion-4 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 9 - 230
Target Start/End: Original strand, 42983365 - 42983586
Alignment:
| Q |
9 |
gcaaagaggaaaatgggatggtgcatttttgatttgttgtgaggatgatagagatggaagagaggatttgaagaaggtggaaaagactccatggaaatgg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42983365 |
gcaaagaggaaaatgggatggtgcatttttgatttgttgtgaggatgatagagatggaagagaggatttgaagaaggtggagaagactccatggaaatgg |
42983464 |
T |
|
| Q |
109 |
aaattcaaagtaaagtgaggaaactcacataacacnnnnnnnnnnnnngattttttgagaggaaatatatattctatactccaagttaggcggtttttaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42983465 |
aaattcaaagtaaagtgaggaaactcacataacacaaaaagaaaaaaagattttttgagaggaaatagatattctatactccaagttaggcggtttttaa |
42983564 |
T |
|
| Q |
209 |
ggttctgttttccctctctctc |
230 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42983565 |
ggttctgttttccctctctctc |
42983586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University