View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_high_14 (Length: 468)
Name: NF1350_high_14
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 98 - 338
Target Start/End: Original strand, 35786628 - 35786868
Alignment:
| Q |
98 |
gatttaacagaatcaccacttgcatgttcaaaatcttgatttagttgttgatgatgatattgttgatggtgttgcacttgcacttgcaccatttcttgat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35786628 |
gatttaacagaatcaccacttgcatgttcaaaatcttgatttagttgttgatgatgatattgttgatgctgttgcacttgcacttgcaccatttcttgat |
35786727 |
T |
|
| Q |
198 |
gagggttatgatgaaaatgaactaaaccattattgttattatagaaaactggttggtgatgatgatgaaaattattgtaaacaccaaatgggacaaaatt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786728 |
gagggttatgatgaaaatgaactaaaccattattgttattatagaaaactggttggtgatgatgatgaaaattattgtaaacaccaaatgggacaaaatt |
35786827 |
T |
|
| Q |
298 |
attgtaaactgagaaaccagaaggacgaggaagtaaaggac |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35786828 |
attgtaaactgagaaaccagaaggacgaggaagtaaaggac |
35786868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 428 - 456
Target Start/End: Original strand, 35786958 - 35786986
Alignment:
| Q |
428 |
ttaagctgagccctagaaccatagagaat |
456 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35786958 |
ttaagctgagccctagaaccatagagaat |
35786986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University