View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_high_27 (Length: 308)
Name: NF1350_high_27
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 37 - 166
Target Start/End: Original strand, 53834563 - 53834689
Alignment:
| Q |
37 |
attagtaccattatgtacactgaatgaagggaacttaatcatattctttaggtatagaaatctgagcttaattctagaatgtgtgtatggatatnnnnnn |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53834563 |
attagtaccattatgtacactgaatgaagggaacttaatcatattctttaggtatagaaatctgagcttaattctagaa--tgtgtatggatat-aaaaa |
53834659 |
T |
 |
| Q |
137 |
nncagaactgtaggaagagataatctaagg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53834660 |
aacagaactgtaggaagagataatctaagg |
53834689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 214 - 279
Target Start/End: Original strand, 53834737 - 53834802
Alignment:
| Q |
214 |
tggacaagacatgcccataaccacattggggcagcgatgatctaaccttgttaaatattattcgac |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
53834737 |
tggacaagacatgcccataaccacattgggacagcgatgatctaaccttgttaaataatattcgac |
53834802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University