View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_high_30 (Length: 277)
Name: NF1350_high_30
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 29 - 231
Target Start/End: Complemental strand, 46731987 - 46731793
Alignment:
| Q |
29 |
agcagcaccacagaacagcacggcacggcagagggtcagatttgtcttggagtgcacaaagataacaacctctgccagtagaagtgatatatgacaatca |
128 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46731987 |
agcagcagaacagaacagcacggcacggcagagggtcagatttgttttggagtgcacaaagataacaacctctgccagtagaagtgatatatgacaatca |
46731888 |
T |
 |
| Q |
129 |
aagacataaggcaaaatatccgtaccttttttggttctattatcattcagtatgcacattgcacagataatatagacaaaatattacaactatttgatga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46731887 |
aagacataaggcaaaatatccgtaccttttttggttctattatcattcagtatg-------cacagataatatagacaaaatattacaacta-ttgatga |
46731796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University