View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_high_32 (Length: 268)
Name: NF1350_high_32
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 36 - 240
Target Start/End: Original strand, 38333888 - 38334092
Alignment:
| Q |
36 |
ggacatcatcaccgttaacagcctcattcaatgagtttttagtaggtttactagctgcttgttttcttggtttccttgaggatttaccacctttatcctc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38333888 |
ggacatcatcaccgttaacagcctcattcaatgagtttttagtaggtttactagctgcttgttttcttggtttccttgaggatttaccacctttatcctc |
38333987 |
T |
 |
| Q |
136 |
cacaccagcaatagaagatattttatgcttctttagagannnnnnnctctcattagcaacctgagaaagcttgcgaataaaattacaaatcatctacacg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38333988 |
cacaccagcaatagaagatattttatgcttctttagagatttttttctctcattagcaacctgagaaagcttgcgaataaaattacaaatcatctacacg |
38334087 |
T |
 |
| Q |
236 |
gtcat |
240 |
Q |
| |
|
||||| |
|
|
| T |
38334088 |
gtcat |
38334092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 36 - 173
Target Start/End: Original strand, 38341641 - 38341778
Alignment:
| Q |
36 |
ggacatcatcaccgttaacagcctcattcaatgagtttttagtaggtttactagctgcttgttttcttggtttccttgaggatttaccacctttatcctc |
135 |
Q |
| |
|
||||||||||| | | |||||||| || |||| |||||||| ||| || | ||||||||||||| || | |||||||| ||||| |||||||||||| |
|
|
| T |
38341641 |
ggacatcatcaacctcaacagccttgttaaatgggtttttagacagttcacgaactgcttgttttctcggctgccttgaggttttactacctttatcctc |
38341740 |
T |
 |
| Q |
136 |
cacaccagcaatagaagatattttatgcttctttagag |
173 |
Q |
| |
|
||||||| |||||| |||| |||||||||||||||||| |
|
|
| T |
38341741 |
cacaccaacaataggagatcttttatgcttctttagag |
38341778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University