View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_low_29 (Length: 366)
Name: NF1350_low_29
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 71 - 355
Target Start/End: Complemental strand, 1144541 - 1144257
Alignment:
| Q |
71 |
acaaagtacatcaatgatgctacaatcttaatgtgggcatacgtaatcacaaattttcaagttcttgattgcttgaagattttcacaaatttccaagtca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1144541 |
acaaagtacatcaatgatgctacaatcttaatgtgggcatacgtaatcacaaattttcaagttcttgattgcttgaagattttcacaaatttccaagtct |
1144442 |
T |
|
| Q |
171 |
tgtatttagagaacaatgcattctttggtgtattgattggttctatttataggtctttctatgagccaaacttgtgatatgaaattgaatgtaggattcc |
270 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1144441 |
tgtatttagagaacaatgcattatttggtgtattgattggttctatttataggtctttctatgagccaaacttgtgatatgaaattgaatgtaggattcc |
1144342 |
T |
|
| Q |
271 |
tagtagggtaaataaaacaatttcctttttggtgtaacacacgacacgaccatcaatcggaatcaataattctttttcgattcat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1144341 |
tagtagggtaaataaaacaatttcctttttggtgtaacacacgacacgaccatcaatcagaatcaataattctttttcgattcat |
1144257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 7e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 77 - 182
Target Start/End: Original strand, 18281348 - 18281453
Alignment:
| Q |
77 |
tacatcaatgatgctacaatcttaatgtgggcatacgtaatcacaaattttcaagttcttgattgcttgaagattttcacaaatttccaagtcatgtatt |
176 |
Q |
| |
|
|||||||||||||||| ||||||| |||| | ||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
18281348 |
tacatcaatgatgctaaaatcttagtgtgtgtatacgtaatcataaattttcaagtacttgattgcttgaatattttcacaaatttccaagtcttgtatt |
18281447 |
T |
|
| Q |
177 |
tagaga |
182 |
Q |
| |
|
|||||| |
|
|
| T |
18281448 |
tagaga |
18281453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 71 - 123
Target Start/End: Complemental strand, 8295317 - 8295265
Alignment:
| Q |
71 |
acaaagtacatcaatgatgctacaatcttaatgtgggcatacgtaatcacaaa |
123 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
8295317 |
acaaagaacatcaatgatgctaaaatcttagtgtgggtatacgtaatcacaaa |
8295265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University