View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_low_47 (Length: 250)
Name: NF1350_low_47
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_low_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 6989190 - 6989446
Alignment:
| Q |
1 |
tgacaagtctaataacatatatggtacattcattcaaacattagtacagcaaataaataattcaactgttttcttattgaattagtgacggaaaa----- |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6989190 |
tgacaagtctaataacatatatggtacattcattcaaacattagtacagcaaataaataattgaactgttttcttattgaattagtgacggaaaatttga |
6989289 |
T |
 |
| Q |
96 |
---------aatgaaatccgtctctaatttgttcggtaattcaaccnnnnnnnagtagagatggaattaaagagtaaagataaaaggattgaaattaatt |
186 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6989290 |
gacggaaaaaatgaaatccgtctctaatttggtcggtaattcaaccttcttttagtagagatggaattaaagagtaaagataaaaggattgaaattaatt |
6989389 |
T |
 |
| Q |
187 |
attaccaatattagaaaaagaatcagaaaatccaggtcgtggtcgtctgcctatgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6989390 |
attaccaatattagaaaaagaatcagaaaatccaggtcgtggtcgtctgcctctgct |
6989446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University