View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_low_48 (Length: 246)
Name: NF1350_low_48
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 51581804 - 51581583
Alignment:
| Q |
1 |
ttaatgcattagcattcatacgaatgcaggacatgttagagacattaagtnnnnnnnnttatagatagttagagaggctctgagattctacccttaaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51581804 |
ttaatgcattagcattcatacgaatgcaggacatgttagagacattaagtaaaaaaaattatagatagttagagaggctctgagattctacccttaaagc |
51581705 |
T |
|
| Q |
101 |
tgacattgtttgcaaattaaagtcaataaaaattagaatgctttataatttgtagaatgattgatatgatattactagcataggagctattcttaaacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51581704 |
tgacattgtttgcaaattaaagtcaataaaaattagaatgctttataatttgtagaatgattgatatgatattactagcataggagctattcttaaacgt |
51581605 |
T |
|
| Q |
201 |
tctttgggatcttagtgtttct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
51581604 |
tctttgggatcttagtgtttct |
51581583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University