View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1350_low_50 (Length: 215)
Name: NF1350_low_50
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1350_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 28 - 195
Target Start/End: Complemental strand, 7634122 - 7633955
Alignment:
| Q |
28 |
tgctcaaaataatctcttgtttttctttctaggtactatgttgcttgcacttgaactgatatgacaattacacctatgctactgagcacttgcaaaaaga |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7634122 |
tgctcaaaataatctcttgtttttctttctaggtactatgttgcttgcacttgaactgatatgacaattacacctatactactgagcacttgcaaaaaga |
7634023 |
T |
|
| Q |
128 |
aatacaaatatgtacatccatggaagtctgaatgacggcaaacataatgctcttttagtggttaaacc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7634022 |
aatacaaatatgtacatccatggaagtctgaatgacggcaaacataatgctcttttagtggttaaacc |
7633955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 87
Target Start/End: Complemental strand, 26643808 - 26643761
Alignment:
| Q |
40 |
tctcttgtttttctttctaggtactatgttgcttgcacttgaactgat |
87 |
Q |
| |
|
||||||||||| || |||||||||| |||||||||||||||||||||| |
|
|
| T |
26643808 |
tctcttgttttcctctctaggtactctgttgcttgcacttgaactgat |
26643761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 89
Target Start/End: Complemental strand, 26657441 - 26657392
Alignment:
| Q |
40 |
tctcttgtttttctttctaggtactatgttgcttgcacttgaactgatat |
89 |
Q |
| |
|
||||||||||| || |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26657441 |
tctcttgttttcctatctaggtactctgttgcttgcacctgaactgatat |
26657392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University