View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1350_low_51 (Length: 204)

Name: NF1350_low_51
Description: NF1350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1350_low_51
NF1350_low_51
[»] chr8 (1 HSPs)
chr8 (94-180)||(39793431-39793517)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 94 - 180
Target Start/End: Original strand, 39793431 - 39793517
Alignment:
94 ctctccctgcaacaggtttgtttctactttccacaaaaaggggactgagcacaacaaaagataccatcatacgaagtggtaggttgc 180  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||    
39793431 ctctccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgc 39793517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University