View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351-INSERTION-2 (Length: 169)
Name: NF1351-INSERTION-2
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 8e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 8e-75
Query Start/End: Original strand, 8 - 161
Target Start/End: Complemental strand, 39778054 - 39777901
Alignment:
| Q |
8 |
ttatgttagcgtaatatttggtttaaaaccagttaattacttgagagtcaagaaatcaatggctcaaaacctaagcaggttttaggttcaaaaatatggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39778054 |
ttatgttagcgtaatatttggtttaaaaccagttaattacttgagagtcaagaaatcaatggctcaaaagctaagcaggttttaggttcaaaaatatggt |
39777955 |
T |
 |
| Q |
108 |
tagtttggtataaaaaagttatcaacttagaatttatttagttttagtataatg |
161 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39777954 |
tagtttggcataaaaaagttagcaacttagaatttatttagttttagtataatg |
39777901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University