View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351-INSERTION-3 (Length: 279)
Name: NF1351-INSERTION-3
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351-INSERTION-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 12 - 161
Target Start/End: Original strand, 1164176 - 1164327
Alignment:
| Q |
12 |
ttaagttcaatacttgttcatcaac-ggattagtttggttcgattttgatagatag-acatttttataatccaaacagactcaactcggccagtgagcaa |
109 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||| ||||| || |||||||| ||| | ||||||||||||| ||||| |||||||| |
|
|
| T |
1164176 |
ttaagttcaatacttgttcatcaacaggattggtttggttcgattgtgatatatcctacatttttttaacctaaacagactcaacccggccggtgagcaa |
1164275 |
T |
|
| Q |
110 |
tcctactctccatgcaacttgttctatcattttcatacttatttcaaacttg |
161 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1164276 |
tcctactctccatgcaactagttctatcattttcatacttatttcaaacttg |
1164327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 1171504 - 1171559
Alignment:
| Q |
102 |
gtgagcaatcctactctccatgcaacttgttctatcattttcatacttatttcaaa |
157 |
Q |
| |
|
|||| ||||||||| | ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1171504 |
gtgaacaatcctacaattcatgcaactagttctatcattttcatacttatttcaaa |
1171559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 196 - 245
Target Start/End: Original strand, 1136747 - 1136796
Alignment:
| Q |
196 |
attgtcagtaaataaccaatggttctctctagaattttaaactcacaagt |
245 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || |||| |||| |
|
|
| T |
1136747 |
attgtcagtaaataaccaaatgttctctctagaatttcaacctcaaaagt |
1136796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 229
Target Start/End: Original strand, 1133135 - 1133183
Alignment:
| Q |
181 |
tgtttctggttctttattgtcagtaaataaccaatggttctctctagaa |
229 |
Q |
| |
|
|||||||| |||||||||||||||||||||| || |||||||||||| |
|
|
| T |
1133135 |
tgtttctgcttctttattgtcagtaaataactaaaatttctctctagaa |
1133183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University