View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13510_low_4 (Length: 272)
Name: NF13510_low_4
Description: NF13510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13510_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 101 - 214
Target Start/End: Complemental strand, 6241800 - 6241687
Alignment:
| Q |
101 |
tatcggtttaatatttccattttgcaaataaaattgaatgactttaacattataattatcttatcacctgtttttagaagatagctttgaaagtaaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6241800 |
tatcggtttaatatttccattttgcaaataaaaatgaatgactttaacattataattatcttatcacctgttttttgaagatagctttgaaagtaaaatt |
6241701 |
T |
 |
| Q |
201 |
cttaggtgctcctt |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6241700 |
cttaggtgctcctt |
6241687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 127 - 263
Target Start/End: Complemental strand, 6241677 - 6241541
Alignment:
| Q |
127 |
aataaaattgaatgactttaacattataattatcttatcacctgtttttagaagatagctttgaaagtaaaattcttaggtgctccttnnnnnnngtaaa |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6241677 |
aataaaaatgaatgactttaacattataattatcttatcacctgttttttgaagatagctttgaaagtaaaattcttaggtgctccttaaaaaaagtaaa |
6241578 |
T |
 |
| Q |
227 |
tttcttaggtgatagttctgcctgtgatagagactaa |
263 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6241577 |
tttcttaggtgatagttttgcctgtgatagagactaa |
6241541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 127 - 263
Target Start/End: Complemental strand, 6212750 - 6212614
Alignment:
| Q |
127 |
aataaaattgaatgactttaacattataattatcttatcacctgtttttagaagatagctttgaaagtaaaattcttaggtgctccttnnnnnnngtaaa |
226 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6212750 |
aataaaaatgaatgactttaacattataattatcttatcacctgttttttgaagatagctttgaaagtaaaattcttaggtgctccttaaaaaaagtaaa |
6212651 |
T |
 |
| Q |
227 |
tttcttaggtgatagttctgcctgtgatagagactaa |
263 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
6212650 |
tttcttaggtgatagttttgcctgtgataaagactaa |
6212614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University