View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13511_high_14 (Length: 244)
Name: NF13511_high_14
Description: NF13511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13511_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 139 - 224
Target Start/End: Original strand, 41636061 - 41636146
Alignment:
| Q |
139 |
gtaagatgagaaaacatgaaccaaataagattagaatcgaacgttgcatgtaaacaccaagcatgtctacttgtcctgcaccatat |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
41636061 |
gtaagatgagaaaacatgaaccaaataagattagaattgaacgttgcatgcaaacaccaaacatatctacttgtcctgcatcatat |
41636146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University