View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13512_high_3 (Length: 292)
Name: NF13512_high_3
Description: NF13512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13512_high_3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 26 - 292
Target Start/End: Original strand, 48074307 - 48074579
Alignment:
| Q |
26 |
aatgaaaaactaagttgcatcaacaaagatgaagatatatgcatatgtaactgctagctatacttcatagtagcttattatagctaatactcttgtaatg |
125 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48074307 |
aatgtaaaactaagttgcatcaacaaagatgaagatatatgcatatgtaactgctagctatacttcatagtagcttattatagctaatactcttgtaatg |
48074406 |
T |
 |
| Q |
126 |
agtacagcaacaggtctcatannnnnnnn------atacacttgattaattaaaatcaaaaccactcactagtgtccccaaccttaatattctgactcca |
219 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48074407 |
agtacagcaacaggtctcatatattttttttttttatacacttgattaattaaaatcaaaaccactcactagtgtccccaaccttaatattctgactcca |
48074506 |
T |
 |
| Q |
220 |
gttaagcacccttgcaagccattcatcgtcaaaatcaccttcttcgtcttcttccatatatttgtattcttca |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48074507 |
gttaagcacccttgcaagccattcatcgtcaaaatcaccttcttcgtcttcttccatatatttgtattcttca |
48074579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University