View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13513_high_11 (Length: 204)
Name: NF13513_high_11
Description: NF13513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13513_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 20 - 191
Target Start/End: Complemental strand, 43985292 - 43985121
Alignment:
| Q |
20 |
ctaatgctgttttggaagcttctgcattgccgttgattgctgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985292 |
ctaatgctgttttggaagcttctgcattgccgttgattactgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgtt |
43985193 |
T |
|
| Q |
120 |
gtctctatgtgttaatggtggtgtggatgttgctggtgttcttgctaaggatgttacacttatgcctttgct |
191 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985192 |
gtctctatgtgttaatggtggtgttgatgttgctggtgttcttgctaaggatgttacacttatgcctttgct |
43985121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University