View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13513_high_9 (Length: 232)
Name: NF13513_high_9
Description: NF13513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13513_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 115 - 175
Target Start/End: Complemental strand, 1904540 - 1904480
Alignment:
| Q |
115 |
tgtggctaatagttcaccaactgaactgaagttcggttatcatcgttgtgattcagtttgg |
175 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1904540 |
tgtgactaatagttcaccaactgaattgaagttcggttatcatcgttgtgattcagtttgg |
1904480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 115 - 175
Target Start/End: Complemental strand, 1908773 - 1908713
Alignment:
| Q |
115 |
tgtggctaatagttcaccaactgaactgaagttcggttatcatcgttgtgattcagtttgg |
175 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1908773 |
tgtgactaatagttcaccaactgaattgaagttcggttatcatcgttgtgattcagtttgg |
1908713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 1904654 - 1904604
Alignment:
| Q |
1 |
cttaattttccacatatatcttctgcaggctccacgtggtggtgtggttgt |
51 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1904654 |
cttaattttccacatatatcttccgcaggctccacgtggtggtgtggttgt |
1904604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 1908887 - 1908837
Alignment:
| Q |
1 |
cttaattttccacatatatcttctgcaggctccacgtggtggtgtggttgt |
51 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1908887 |
cttaattttccacatatatcttccgcaggctccacgtggtggtgtggttgt |
1908837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University