View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13513_high_9 (Length: 232)

Name: NF13513_high_9
Description: NF13513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13513_high_9
NF13513_high_9
[»] chr6 (4 HSPs)
chr6 (115-175)||(1904480-1904540)
chr6 (115-175)||(1908713-1908773)
chr6 (1-51)||(1904604-1904654)
chr6 (1-51)||(1908837-1908887)


Alignment Details
Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 115 - 175
Target Start/End: Complemental strand, 1904540 - 1904480
Alignment:
115 tgtggctaatagttcaccaactgaactgaagttcggttatcatcgttgtgattcagtttgg 175  Q
    |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
1904540 tgtgactaatagttcaccaactgaattgaagttcggttatcatcgttgtgattcagtttgg 1904480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 115 - 175
Target Start/End: Complemental strand, 1908773 - 1908713
Alignment:
115 tgtggctaatagttcaccaactgaactgaagttcggttatcatcgttgtgattcagtttgg 175  Q
    |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
1908773 tgtgactaatagttcaccaactgaattgaagttcggttatcatcgttgtgattcagtttgg 1908713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 1904654 - 1904604
Alignment:
1 cttaattttccacatatatcttctgcaggctccacgtggtggtgtggttgt 51  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||    
1904654 cttaattttccacatatatcttccgcaggctccacgtggtggtgtggttgt 1904604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 1908887 - 1908837
Alignment:
1 cttaattttccacatatatcttctgcaggctccacgtggtggtgtggttgt 51  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||    
1908887 cttaattttccacatatatcttccgcaggctccacgtggtggtgtggttgt 1908837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University