View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13515_high_2 (Length: 292)
Name: NF13515_high_2
Description: NF13515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13515_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 33 - 271
Target Start/End: Original strand, 14658627 - 14658863
Alignment:
| Q |
33 |
ttctccaaccagtgtttttagaaacaaagggcacatattcgatgatcatagcactaagttacttctgacctaattgatattccttttagctaaaaaccat |
132 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
14658627 |
ttctccaaccagtgttgttagaaacaaagggcacatattcgatgatcatagtactaagttacttttgacctaattgatattctttttagctaaaaatcat |
14658726 |
T |
 |
| Q |
133 |
tatgtatgtttataaatttgattttacatgatcttgattctacaaaattgatttcagtgtaaatacatttacgttgctgctggttactcttgggtcacat |
232 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
14658727 |
tatgtatgcttataaatttgattttgcatgatcttgattctacaaaattgatttcagtataaatacatttacattgttgctggttactcttgggtcac-- |
14658824 |
T |
 |
| Q |
233 |
ataattggagagtttcacataggaagttagacttataag |
271 |
Q |
| |
|
|| |||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
14658825 |
attattggagagtttcacataagaagtaagacttgtaag |
14658863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University