View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13515_low_1 (Length: 423)
Name: NF13515_low_1
Description: NF13515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13515_low_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 6e-81; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 228 - 380
Target Start/End: Complemental strand, 46249279 - 46249127
Alignment:
| Q |
228 |
tttgtagtaatggaaaacaaggtggaggatcccaatgggatttctaaatttaagatatcggagccgttgagagaaaagttgaaggaaaagggaattgagt |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46249279 |
tttgtagtaatggaaaacaaggtggaggatcccaatgggatttctaaatttaagatatcggagccgttgagagaaaagttgaaggaaaagggaattgagt |
46249180 |
T |
 |
| Q |
328 |
cattgtttcctattcaggctatgacttttgatatcattcttcaaggttgtgat |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46249179 |
cattgtttcctattcaggctatgacttttgatatcattcttcaaggttgtgat |
46249127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 111 - 182
Target Start/End: Complemental strand, 46249396 - 46249325
Alignment:
| Q |
111 |
cgtaaggcttccgtgttatagacaatgacgacgaccaatagagacgataatgagaatagtttagagttggat |
182 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46249396 |
cgtaaggcttccatgttatagacaatgacgacgaccaatggagacgataatgagaatagtttagagttggat |
46249325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 6 - 45
Target Start/End: Complemental strand, 46249501 - 46249462
Alignment:
| Q |
6 |
aaaaaacccaatctcaaaccgaaccagaaggttcaatctc |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46249501 |
aaaaaacccaatctcaaaccgaaccagaaggttcaatctc |
46249462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University